Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: RFL_Contig1959_244

[Submit comment/correction]

Sequence	RFL_Contig1959_244
Contig	7BL_6527738
Probe	RFL_Contig1959_244
DNA Homology	7BL_6527738 Best IWGSC match 152 8e-35 URGI_Best IWGSC_N
BLAST, e-value	8e-35 7BL_6527738 Best IWGSC match
DNA	tcgggggttttcggcagggtgttcgggaagtccaaggagcagagccaggc Rtccgcgctggcctccatcgacaagctcagcgagactcttgaaatgttgg a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.