Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: tplb0031l19_267

[Submit comment/correction]

Sequence	tplb0031l19_267
Contig	7DL_3341642
Probe	tplb0031l19_267
DNA Homology	7DL_3341642 Best IWGSC match 113 4e-23 URGI_Best IWGSC_N
BLAST, e-value	4e-23 7DL_3341642 Best IWGSC match
DNA	gccggggcagcagcagcagcagctggagcaccacctccaccagatccgac Rgaaaggatgaggtcatcgacgctcctcttctccaggagcttggcgaaga g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.