Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Excalibur_c25739_387

[Submit comment/correction]

Sequence	Excalibur_c25739_387
Contig	7DS_3904460
Probe	Excalibur_c25739_387
DNA Homology	7DS_3904460 Best IWGSC match 148 1e-33 URGI_Best IWGSC_N
BLAST, e-value	1e-33 7DS_3904460 Best IWGSC match
DNA	ggtgccctcggtggcaccactacgcccacgacaatccgcggatgcttaca Rtcctcgacgaccaccgccgctagctcatgctggtctaatgatggtcgcc c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.