Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 7AL_4553019

[Submit comment/correction]

Sequence	BobWhite_rep_c51260_160
Contig	7AL_4553019
Probe	BobWhite_rep_c51260_160
DNA Homology	7AL_4553019 Best IWGSC match 159 5e-37 URGI_Best IWGSC_N
BLAST, e-value	5e-37 7AL_4553019 Best IWGSC match
DNA	gccgcgctgccgaagaagccgcagttattgacgcaaaggatggggccctc Mcgagactggcagccggtctccttgtgctccatggtctttgtatttaact g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.