Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: wsnp_Ex_c21068_30195276

[Submit comment/correction]

Sequence	wsnp_Ex_c21068_30195276
Contig	7AS_707506
Probe	wsnp_Ex_c21068_30195276
DNA Homology	7AS_707506 Best IWGSC match 302 0 URGI_Best IWGSC_N
BLAST, e-value	0 7AS_707506 Best IWGSC match
DNA	gaagtgcattccaaatcggaatggcgtcgtcgtcggggccttgaggggtg gtagatcttcgcgcgtccggggatgagacaaagaggaaggagaaggaagg Rcgaggagcgcccggaggaggcggatcgagtcacggggtacccgaccaag gagctgcctgtgggctctcgtgctgcgcggctcgggagttgcgacgagtg a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.