Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: RAC875_c32212_84

[Submit comment/correction]

Sequence	RAC875_c32212_84
Contig	7AL_4553164
Probe	RAC875_c32212_84
DNA Homology	7AL_4553164 Best IWGSC match 172 7.00005e-41 URGI_Best IWGSC_N
BLAST, e-value	7.00005e-41 7AL_4553164 Best IWGSC match
DNA	ccagtgtagtgtggatcaaggatgagaaaagcacaatcaccgctggcttc Rttgtaatcaactcccagaagggtataagccaaaactccaccaccaatca t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.