Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 7AL_4466197

[Submit comment/correction]

Sequence	wsnp_BQ171683A_Ta_2_1
Contig	7AL_4466197
Probe	wsnp_BQ171683A_Ta_2_1
DNA Homology	7AL_4466197 Best IWGSC match 139 5e-31 URGI_Best IWGSC_N
BLAST, e-value	5e-31 7AL_4466197 Best IWGSC match
DNA	AGATCCCTGTTTAGGATTCAGGATTAGTCAAGTTCGTAATTTGGGAGACT TGGACAGGACKAATGCACTTCTGATGCG

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.