Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 7BL_6728942

[Submit comment/correction]

Sequence	RAC875_c6475_383
Contig	7BL_6728942
Probe	RAC875_c6475_383
DNA Homology	7BL_6728942 Best IWGSC match 167 3e-39 URGI_Best IWGSC_N
BLAST, e-value	3e-39 7BL_6728942 Best IWGSC match
DNA	ccctcggcaaccttgaatatccactctgtagcaaagaactgagcctcatc Rttgccagcctcactgcctgagatgccttcagccagaggctccaactgct g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.