Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Excalibur_c14451_1313

[Submit comment/correction]

Sequence	Excalibur_c14451_1313
Contig	7AL_4435482
Probe	Excalibur_c14451_1313
DNA Homology	7AL_4435482 Best IWGSC match 178 1.00053e-42 URGI_Best IWGSC_N
BLAST, e-value	1.00053e-42 7AL_4435482 Best IWGSC match
DNA	gcgccagacaccattgtcaatcaaggttgacatgatgatttgatcatttt Rcgaccaaaaagtctcctggaactcccaatcaaggaaaacgaaaggttcc c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.