Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: TA002938-0337

[Submit comment/correction]

Sequence	TA002938-0337
Contig	7DL_3344608
Probe	TA002938-0337
DNA Homology	7DL_3344608 Best IWGSC match 97 2e-18 URGI_Best IWGSC_N
BLAST, e-value	2e-18 7DL_3344608 Best IWGSC match
DNA	gcattctcccgacttgagagacaaatgcaatgcatagtgaggagaaccgg Rgat

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.