Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: RFL_Contig801_2124

[Submit comment/correction]

Sequence	RFL_Contig801_2124
Contig	7AS_4192603
Probe	RFL_Contig801_2124
DNA Homology	7AS_4192603 Best IWGSC match 178 1.00053e-42 URGI_Best IWGSC_N
BLAST, e-value	1.00053e-42 7AS_4192603 Best IWGSC match
DNA	cttggaagtagcccatcccttgtcatgccacggaggacatcaaccacagc Rtccacgttaccttccttccgattgagatcaataagagccttcgatgttt c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.