Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: TA001320-0384

[Submit comment/correction]

Sequence	TA001320-0384
Contig	7DS_3924676
Probe	TA001320-0384
DNA Homology	7DS_3924676 Best IWGSC match 97 2e-18 URGI_Best IWGSC_N
BLAST, e-value	2e-18 7DS_3924676 Best IWGSC match
DNA	cctggtgttattggagctggagttggtgttgatgacgtcaataggatgaa Rtac

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.