Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BobWhite_rep_c64768_264

[Submit comment/correction]

Sequence	BobWhite_rep_c64768_264
Contig	7DS_3891738
Probe	BobWhite_rep_c64768_264
DNA Homology	7DS_3891738 Best IWGSC match 128 1e-27 URGI_Best IWGSC_N
BLAST, e-value	1e-27 7DS_3891738 Best IWGSC match
DNA	tgatgtacagtattgccatatggtgaggtaaccttgacggcgacggtggg Rtgggcggtggcgtgggcctcgtacatgagcatgtagtccgcgaccacca c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.