Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 7BS_3094371

[Submit comment/correction]

Sequence	RAC875_rep_c106792_398
Contig	7BS_3094371
Probe	RAC875_rep_c106792_398
DNA Homology	7BS_3094371 Best IWGSC match 180 3.9937e-43 URGI_Best IWGSC_N
BLAST, e-value	3.9937e-43 7BS_3094371 Best IWGSC match
DNA	atcgctrcaccatcgcacaaaatttagccctacagcatccatacttagcc Rccaccggacccatacttcttgccaaagacgaccacctggagcttgtcat a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.