Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: RAC875_c35186_372

[Submit comment/correction]

Sequence	RAC875_c35186_372
Contig	7DS_3963467
Probe	RAC875_c35186_372
DNA Homology	7DS_3963467 Best IWGSC match 113 2e-23 URGI_Best IWGSC_N
BLAST, e-value	2e-23 7DS_3963467 Best IWGSC match
DNA	tggccataggtgtgcgggaacgcgcggcggatcacatgcgcgtcagcgcc Rtcagccgcgatc

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.