Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: wsnp_RFL_Contig3258_3294392

[Submit comment/correction]

Sequence	wsnp_RFL_Contig3258_3294392
Contig	7BL_6730773
Probe	wsnp_RFL_Contig3258_3294392
DNA Homology	7BL_6730773 Best IWGSC match 159 4e-37 URGI_Best IWGSC_N
BLAST, e-value	4e-37 7BL_6730773 Best IWGSC match
DNA	tgcctcggcatcagcttcatcagaacgcatatttgaacttggagcagggc Rccgggccataatagtaatccccgttgattgagcatca

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.