Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 7AL_4528861

[Submit comment/correction]

Sequence	RAC875_rep_c112798_813
Contig	7AL_4528861
Probe	RAC875_rep_c112798_813
DNA Homology	7AL_4528861 Best IWGSC match 183 2.94273e-44 URGI_Best IWGSC_N
BLAST, e-value	2.94273e-44 7AL_4528861 Best IWGSC match
DNA	ttgagatcaccattttctgacaagaacttgccaactggatcatctgcttt Rtaatcctcctcttttgccagccaggcaaacatgtacttgtcacttttat t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.