Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Ra_c4742_258

[Submit comment/correction]

Sequence	Ra_c4742_258
Contig	7BL_6729065
Probe	Ra_c4742_258
DNA Homology	7BL_6729065 Best IWGSC match 183 2.94273e-44 URGI_Best IWGSC_N
BLAST, e-value	2.94273e-44 7BL_6729065 Best IWGSC match
DNA	gagcagcagggacgtgaggagtagggaggagcagcagggacgtgaggagt Rgggaggagcagcaggggaagaagagatcgtgcgagcggtggcgcggcag c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.