Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: IAAV3414

[Submit comment/correction]

Sequence	IAAV3414
Contig	7BL_6732818
Probe	IAAV3414
DNA Homology	7BL_6732818 Best IWGSC match 254 0 URGI_Best IWGSC_N
BLAST, e-value	0 7BL_6732818 Best IWGSC match
DNA	aacagaactgaatccaaagtatcgtctaaactgcaaaatcccagatgatt cactaggacaaaacactagtagcaacttatgcttcagtctgctccctcaa Rcgacggatagtgctcctgacagtgaccgcactggcagtnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn n

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.