Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Tdurum_contig29893_155

[Submit comment/correction]

Sequence	Tdurum_contig29893_155
Contig	5AS_1526231
Species	Triticum aestivum
Probe	Tdurum_contig29893_155
DNA Homology	5AS_1526231 Best IWGSC match 178 1.00053e-42 URGI_Best IWGSC_N
BLAST, e-value	1.00053e-42 5AS_1526231 Best IWGSC match
DNA	tcacgcagcagccacgacgcgctgcccgcccgaccataaccagctcgtcg Rctagacgaggacgcctccaacccctgagtcgtggactgcgcccgactgt g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.