Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Excalibur_rep_c69070_180

[Submit comment/correction]

Sequence	Excalibur_rep_c69070_180
Contig	7DL_3354930
Probe	Excalibur_rep_c69070_180
DNA Homology	7DL_3354930 Best IWGSC match 165 1e-38 URGI_Best IWGSC_N
BLAST, e-value	1e-38 7DL_3354930 Best IWGSC match
DNA	gatctgaactccctcatgatgatgtccctagtgttctggtccatgtctcc Rtgagtggcggagactgtgtggtcccctgccccctcatcttgtcggtgag c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.