Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: wsnp_RFL_Contig2766_2515703

[Submit comment/correction]

Sequence	wsnp_RFL_Contig2766_2515703
Contig	7DL_3366774
Probe	wsnp_RFL_Contig2766_2515703
DNA Homology	7DL_3366774 Best IWGSC match 172 7.00005e-41 URGI_Best IWGSC_N
BLAST, e-value	7.00005e-41 7DL_3366774 Best IWGSC match
DNA	tgttgctaaacaaatccagtgatccagatatcaacacacgagcattattc Mtagcctgcataacagaaaccagcgatatggccgacccagtgagagatgg a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.