Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BobWhite_rep_c52876_72

[Submit comment/correction]

Sequence	BobWhite_rep_c52876_72
Contig	7AL_4552525
Probe	BobWhite_rep_c52876_72
DNA Homology	7AL_4552525 Best IWGSC match 97 4e-18 URGI_Best IWGSC_N
BLAST, e-value	4e-18 7AL_4552525 Best IWGSC match
DNA	aatacagccccccatccgatctcgccgggaaatctctccgatcgaagcga Rgcgaaggctctctcgtcctcctcctcaagatgcagatcttcgtgaagac c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.