Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: wsnp_BE498985A_Ta_2_1

[Submit comment/correction]

Sequence	wsnp_BE498985A_Ta_2_1
Contig	7BL_6485684
Probe	wsnp_BE498985A_Ta_2_1
DNA Homology	7BL_6485684 Best IWGSC match 180 3.9937e-43 URGI_Best IWGSC_N
BLAST, e-value	3.9937e-43 7BL_6485684 Best IWGSC match
DNA	CCCTGAGCAAAAGGAGCCCCCATGTCCAGCTTCCCCAGATCAATGGTCCA CGCCTCATAGYTAGTGAGTATCTCTGTTGGATGAGTCGGGTCCATCAAAA CC

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.