Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Ku_c31231_285

[Submit comment/correction]

Sequence	Ku_c31231_285
Contig	7DL_2956374
Probe	Ku_c31231_285
DNA Homology	7DL_2956374 Best IWGSC match 161 1e-37 URGI_Best IWGSC_N
BLAST, e-value	1e-37 7DL_2956374 Best IWGSC match
DNA	gtcgcccagcattgctccatcagcgacctccactctgggtcgcatgagtc Rggcacctgcggccgcagagtgttgctcacaatgccaccaatgataacac c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.