Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: RFL_Contig2905_931

[Submit comment/correction]

Sequence	RFL_Contig2905_931
Contig	7DL_3334815
Probe	RFL_Contig2905_931
DNA Homology	7DL_3334815 Best IWGSC match 178 1.00053e-42 URGI_Best IWGSC_N
BLAST, e-value	1.00053e-42 7DL_3334815 Best IWGSC match
DNA	tggtactgcaggacgagctgcttcaggccctgcacctcgtggctccgctc Rtcaaactccttctgccgctcgtgctggatcgccaccgcgcgcttcagga c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.