Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: RAC875_c10372_542

[Submit comment/correction]

Sequence	RAC875_c10372_542
Contig	7DL_3393461
Probe	RAC875_c10372_542
DNA Homology	7DL_3393461 Best IWGSC match 126 5e-27 URGI_Best IWGSC_N
BLAST, e-value	5e-27 7DL_3393461 Best IWGSC match
DNA	tcgacctccttggttgcccacaagtaaatggggaagttgatgaactcaga Rtacttcttcaccaagtccttcagcttgccttcttccaagtactccttag c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.