Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Excalibur_c23777_74

[Submit comment/correction]

Sequence	Excalibur_c23777_74
Contig	7BL_6642062
Probe	Excalibur_c23777_74
DNA Homology	7BL_6642062 Best IWGSC match 178 1.00053e-42 URGI_Best IWGSC_N
BLAST, e-value	1.00053e-42 7BL_6642062 Best IWGSC match
DNA	ggccacaaggaggcgctcatgacggtcctcgagaccttcatccacgaccc Rctagtggagtggaccaaagcccacaagtccagcggaggggaggtccgaa a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.