Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Tdurum_contig52096_330

[Submit comment/correction]

Sequence	Tdurum_contig52096_330
Contig	7BL_6576501
Probe	Tdurum_contig52096_330
DNA Homology	7BL_6576501 Best IWGSC match 172 7.00005e-41 URGI_Best IWGSC_N
BLAST, e-value	7.00005e-41 7BL_6576501 Best IWGSC match
DNA	agcgaccatgggctgggcgggtacgagatccggggacacaggtggatcac Raaggagtgaggaggatgaggatcgacgcccggtctgcactgcagcatcg a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.