Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BS00087197_51

[Submit comment/correction]

Sequence	BS00087197_51
Contig	7BL_6739810
Probe	BS00087197_51
DNA Homology	7BL_6739810 Best IWGSC match 113 4e-23 URGI_Best IWGSC_N
BLAST, e-value	4e-23 7BL_6739810 Best IWGSC match
DNA	gtcgtcgtcccgctgcctgctataacggacagcgctccctgttggcgccg Mcgccggcgggggtggtgccctggcggcggagggtgtatgtcctctgccg c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.