Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 7DL_3361936

[Submit comment/correction]

Sequence	D_GBF1XID02G9MOH_157
Contig	7DL_3361936
Probe	D_GBF1XID02G9MOH_157
DNA Homology	7DL_3361936 Best IWGSC match 459 0 URGI_Best IWGSC_N
BLAST, e-value	0 7DL_3361936 Best IWGSC match
DNA	gcgcagcatacataccagtgaagagtgtgaaagcagtgggcagctcccgc ttctcggtctcattcatccacagcagatcttgcttcgtcttcatgtagag gccacggtcaacgacgaccggcatcRccctcgcaggcctggcaagaacaa tcagggcggactcagtcgcgatcccgacaatgctgcatccatcatcgact ctctggtcttatgattacaacacaggcacatacgctttccaacccaggtc

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.