Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Ku_c3676_1280

[Submit comment/correction]

Sequence	Ku_c3676_1280
Contig	7BL_6641439
Probe	Ku_c3676_1280
DNA Homology	7BL_6641439 Best IWGSC match 147 4e-33 URGI_Best IWGSC_N
BLAST, e-value	4e-33 7BL_6641439 Best IWGSC match
DNA	gcattgctctacttgcaaacccagcactttgattgggagccgggccacta Rggttctctgcaaactggccagtagagggtagtgaaattccctccgccca a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.