Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: RFL_Contig2647_624

[Submit comment/correction]

Sequence	RFL_Contig2647_624
Contig	7BL_6699942
Probe	RFL_Contig2647_624
DNA Homology	7BL_6699942 Best IWGSC match 139 6e-31 URGI_Best IWGSC_N
BLAST, e-value	6e-31 7BL_6699942 Best IWGSC match
DNA	tcgttttttttttttttttgcaggaaattaattatcaggaaatcRtcatc atcatggttgagtgagaatgaggaggctgcaatgcaactcaacac

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.