Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: RFL_Contig71_386

[Submit comment/correction]

Sequence	RFL_Contig71_386
Contig	7AL_4481959
Probe	RFL_Contig71_386
DNA Homology	7AL_4481959 Best IWGSC match 156 7e-36 URGI_Best IWGSC_N
BLAST, e-value	7e-36 7AL_4481959 Best IWGSC match
DNA	aagtgcctgatccggcccacctgctccgcgaggtacgcgtcgcacaggaa Mgccttggagaacctgtcctccaccgtccggtccacgtcgtgcacgaaca c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.