Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 7DL_3371209

[Submit comment/correction]

Sequence	BobWhite_rep_c50659_205
Contig	7DL_3371209
Probe	BobWhite_rep_c50659_205
DNA Homology	7DL_3371209 Best IWGSC match 156 7e-36 URGI_Best IWGSC_N
BLAST, e-value	7e-36 7DL_3371209 Best IWGSC match
DNA	ctgcggctccacaatttggccggcgggcatcccggtgggtgggggcttcg Mgctgggcgcaggccagacgtccagcatcaacgtgcccgcgggcaccaaa g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.