Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 7DS_3903708

[Submit comment/correction]

Sequence	BobWhite_c28009_397
Contig	7DS_3903708
Probe	BobWhite_c28009_397
DNA Homology	7DS_3903708 Best IWGSC match 174 1.99993e-41 URGI_Best IWGSC_N
BLAST, e-value	1.99993e-41 7DS_3903708 Best IWGSC match
DNA	aagcaataatgtgactcccaggtgcctctctgagagaaaagctggagatg Mtttgccagtggcaaaacaaagggaagtaattgccgcggacgccag

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.