Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 7DS_3961038

[Submit comment/correction]

Sequence	BobWhite_rep_c65034_450
Contig	7DS_3961038
Probe	BobWhite_rep_c65034_450
DNA Homology	7DS_3961038 Best IWGSC match 169 8e-40 URGI_Best IWGSC_N
BLAST, e-value	8e-40 7DS_3961038 Best IWGSC match
DNA	aggggtgttgggcgccggcgggcgcaaacgggttcgcgccgaatgggttc Rctggggccgcctgtgcctggtggtattgttgtgcctgagggtggtggct g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.