Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: RAC875_c10023_831

[Submit comment/correction]

Sequence	RAC875_c10023_831
Contig	7DL_3355484
Probe	RAC875_c10023_831
DNA Homology	7DL_3355484 Best IWGSC match 110 5e-22 URGI_Best IWGSC_N
BLAST, e-value	5e-22 7DL_3355484 Best IWGSC match
DNA	ctgaagaccgggaggaggcgattctgccaagcatgacctaggagtggtgc Rtttttttcccttgttggtgttctatgtgtcccgaccaccctggcgctca a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.