Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BobWhite_c1514_523

[Submit comment/correction]

Sequence	BobWhite_c1514_523
Contig	3AS_3398846
Species	Triticum aestivum
Chromosome	3A
Probe	BobWhite_c1514_523
Reference	Wang S et al. (2014) Characterization of polyploid wheat genomic diversity using a high-density 90 000 single nucleotide polymorphism array. Plant Biotechnology Journal 12:787-796.
DNA	aaatactttggatatgagggagagcgggtcatccaccctgtccagaccta Ygccatgtactacttctgcttccactacttcaagaggatcatggagacct t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.