Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 4DS_2287564

[Submit comment/correction]

Sequence	BobWhite_rep_c61871_254
Contig	4DS_2287564
Species	Triticum aestivum
Chromosome	4D
Probe	BobWhite_rep_c61871_254
Reference	Wang S et al. (2014) Characterization of polyploid wheat genomic diversity using a high-density 90 000 single nucleotide polymorphism array. Plant Biotechnology Journal 12:787-796.
DNA	aggaggagtaaaggggcacagcaaggtactttgcctgtaccggcaggatg Yaccgaccagactgccaagaacttcgacccaacggcgaggagtgacgacg g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.