Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 2DL_5168164

[Submit comment/correction]

Sequence	CAP12_c2794_440
Contig	2DL_5168164
Species	Triticum aestivum
Probe	CAP12_c2794_440
DNA	GCTGATAACGTGTAAAAGAACGATTTGATCGAAGTGTCTTATTCCATTGA YGATCACACAKTTATAC

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.