Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 5AL_2742593

[Submit comment/correction]

Sequence	CAP7_c10566_556
Contig	5AL_2742593
Species	Triticum aestivum
Probe	CAP7_c10566_556
DNA	TACTGTCCACCGGCACGTCTCGCCATTTGACCATATTTTACACCGACTAC RCAACCATATTGTATTCCAAATCCTATTGGGTCCAC

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.