Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: CAP7_c133_586

[Submit comment/correction]

Sequence	CAP7_c133_586
Contig	3AL_2029359
Species	Triticum aestivum
Probe	CAP7_c133_586
DNA	CCTTGTACATACAGTTCAGTTTTTCTCTCTATAAATATATAAAACGTGAG RCAAGCATTATGTGGCT

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.