Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Ex_c69252_628

[Submit comment/correction]

Sequence	Ex_c69252_628
Contig	7BL_6641439
Species	Triticum aestivum
Probe	Ex_c69252_628
DNA	ctgcggaaagaatcaaacctcccaaacgcgtcgttgctgccaccgagctc Rgcgctgctcccgaaggaatcgaagcgtgagaagctgtcacgcggctgcc c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.