Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Excalibur_c36291_215

[Submit comment/correction]

Sequence	Excalibur_c36291_215
Contig	2AL_6418245
Species	Triticum aestivum
Probe	Excalibur_c36291_215
DNA	gacatgggtggggatcactgcttcttgcctggtggcaacgggaggcttgt Rcaggccctggcagagaatgtgcccattgtttacgagaggacagtgcaca c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.