Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Excalibur_rep_c107369_454

[Submit comment/correction]

Sequence	Excalibur_rep_c107369_454
Contig	5AL_1416160
Species	Triticum aestivum
Probe	Excalibur_rep_c107369_454
DNA	gccaccgattcctctgatgaagatgatcggcatgcgaagaaggaaaagag Ratgacaatggaggtactagttccaatgaaaacctccggacctctcaagt c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.