Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: GENE-2379_213

[Submit comment/correction]

Sequence	GENE-2379_213
Contig	1DL_2272835
Species	Triticum aestivum
Probe	GENE-2379_213
DNA	AAAGATGGCACCATGTACACACTACACAGTAGTGCATAACTTTAACATAA KAAGTAAAAGGAAARTCATTACRTTRGGRCCATGT

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.