Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: GENE-3061_338

Sequence	GENE-3061_338
Contig	3DL_6955441
Species	Triticum aestivum
Probe	GENE-3061_338
DNA	TACTATCAAGCATTCAAATGCCGTTTGTATGGCAATGATATGCTGATTTG YCATATGTTCATTTCTGAAGATTRATRAAGATACACTTCAAGA

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.