Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Ra_c26531_622

[Submit comment/correction]

Sequence	Ra_c26531_622
Contig	4AL_7160751
Species	Triticum aestivum
Probe	Ra_c26531_622
DNA	GCTGAGCTGGTAGGAAAGCTGATAATCCTCCTAGTGCTTGTTTATGTGAA RTATGTTTCTTCTGAG

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.