Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BE403622

[Submit comment/correction]

Sequence	BE403622
Contig	NSFT03P2_Contig9570
Tracefile	[ Download ] [ View ]
External Databases	Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index	TC326627
wEST map position	BE403622
NCBI UniGene	Ta.55930
DB Remark	Locus Source: Triticum aestivum (bread wheat) UniGene title 'Transcribed locus, strongly similar to NP_001061055.1 Os08g0162100 [Oryza sativa (japonica cultivar-group)]'
Keyword	EST
Germplasm	Chinese Spring
Species	Triticum aestivum
Cultivar	Chinese Spring
Chromosome	4AL [ Show all 6 ]
Clone Library	Wheat etiolated seedling root cDNA library
Tissue	Root
Developmental Stage	Five day old etiolated seedling
Data Source	genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title	WHE0434_G05_M10ZS Wheat etiolated seedling root cDNA library Triticum aestivum cDNA clone WHE0434_G05_M10, mRNA sequence.
Other Name	WHE0434_G05_M10ZS  [ wEST-mySQL (obsolete) ]
Strain	lab_host E. coli SOLR
DNA Library	TA008E1X
Clone	WHE0434_G05_M10
Probe	WHE0434_G05_M10
Remark	DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequence have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: Strategene SK primer. Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Seeds were surface-sterilized , germinated and grown aseptically in the dark at room temperature on filter paper with water, nystatin and cefotaxime in covered crystallization dishes. Roots were harvested. The tissue, total RNA, and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors). Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Seeds were surface-sterilized, germinated and grown aseptically in the dark at room temperature on filter paper with water, nystatin and cefotaxime in covered crystallization dishes. Roots were harvested. The tissue, total RNA, and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA	accgctactccatgaagatattctttgagatccgcaagcagaagtacctt gaagccctcgacaggcatgatcgggccaaggcagtggagatactcgtcaa ggatttgaaggtgtttgcctcctttaacgaggagctgttcaaggagataa cgcagctgctgactctggataattttaggcaaaatgagcagctgtccaaa tacggggatacaaagtcagcccggaatatcatgctcatggagcttaagaa gcttatcgaggcaaaccctctgttccgagacaagcttaatttcccaccat ttaaagcctcaagactgcgcacgttgattaatcaaagtcttaactggcaa catcagctctgcaagaatcctagaccaaaccctgacataaagacactctt cacggatcactcctgtgctgctcctaccaatggagcaagagctcctcccc ctgccaatggtcctcttgttggaccaatccccaaaacagctggattccct ccaatgggtgctcatgctccgtttcaacccgtgggttcaccatctccaaa tgcaattgctggttggatgacaaatcccaatccctccttaccacatcctg ctattgcacaagggccgcccggtcttgttcagccaccaaacacagcggca tttctgaagcatccaaggactcctacaagtgcgcctggcattgactatca gtctgcagattctgaacatctgatgaaa

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.